Home Archives Random Quotes Latest Comments Top 100 Submit Quote Search Log In Forums

Quote# 76040

Flatland: Here's an example of a genetic sequence:
acaagatgccattgtcccccggcctcctgc

Please give us an example of what "new code" would look like.

------------------

Heaven-Sent: how about adding any letter besides a, c, g, or t.

Heaven-Sent, ChristianForums 75 Comments [9/14/2010 10:00:29 AM]
Fundie Index: 125
WTF?! || meh
Username:
Comment:



1 2 3
#1207283
Power Skunk

DNA Understanding FAIL.

9/14/2010 10:03:28 AM

#1207289


u

9/14/2010 10:10:09 AM

#1207292


Geneticists have been able to make new nucleotides, after all, they are just a class of chemicals. Even to the extent of making new nucleic acid analogues. They've also been able to code for amino acids that don't occur in nature, and have four-letter (instead of three-letter) codons for the genes. I would imagine you have no idea what that means.

That doesn't just happen in the laboratory, though. Mitochrondial DNA has a slightly different genetic code to the rest of the cell, sometimes nucleotides are modified in cells, non-standard amino acids in natural species...

9/14/2010 10:14:26 AM

#1207295
Berny

This is your brain on religion.

9/14/2010 10:17:20 AM

#1207301
macavitykitsune

How about a nice F, O and D to add to that A you already have?

9/14/2010 10:31:45 AM

#1207307
Vince

We're gonna need a bigger post.


No really, several thousand pages of letters. But hey, you asked for it.

9/14/2010 10:39:52 AM

#1207310
Papabear

Uh, and that shows what exactly?

9/14/2010 10:54:31 AM

#1207311
GigaGuess

*Headdesk*

9/14/2010 10:57:00 AM

#1207312
TGRwulf

WOW!

That is a fucking science fail of epic proportions...

9/14/2010 10:57:51 AM

#1207313
Lucilius

How about an R, an E, the already-familiar T and A, another R, and a D?

9/14/2010 10:58:04 AM

#1207322
Wozza

Hold the phone, we have a winner.

9/14/2010 11:25:58 AM

#1207323
Rapax Pringer

Heaven-Sent, please develop a firm understanding of the subject in question before you start answering those kinds of questions.

Also, I read "cat" in there. I dunno. I observe stuff.

9/14/2010 11:29:20 AM

#1207324
breakerslion

Do not reproduce! Get a vasectomy or have your tubes tied. You are too stupid to even keep your mouth shut concerning those things you are too stupid to comprehend. Your predicted mate is as horrifyingly stupid as you are. Your offspring might blow up a whole neighborhood out of sheer stupidity at the very least! Did your father sit too close to an old-fashioned color TV set (with his legs open) when he was a boy?

9/14/2010 11:29:31 AM

#1207325
SurfinSeaOtter

U

Uracil, only found in RNA though. But hey, it's another letter! :)

9/14/2010 11:34:06 AM

#1207326
aaa

This quote should be in the top 100.

9/14/2010 11:34:30 AM

#1207328
DevilsChaplain

You...have no idea what those letters are for...do you?...

9/14/2010 11:35:02 AM

#1207330
DevilsChaplain

In fact, I last took biology in high school and even I remember the basics of DNA...my brain hurts now.

9/14/2010 11:36:11 AM

#1207331
Bizarro

I'd like to buy an "e".

I think I'll solve the puzzle. Is it "You must have failed biology"?

9/14/2010 11:41:45 AM

#1207338
Doctor Whom

You should have learned better in the eighth grade -- you know, those three dreadful years in your past.

9/14/2010 11:54:38 AM

#1207343
Old Viking

iamdemonstrablyamoron

This sequence can't be altered.

9/14/2010 12:05:00 PM

#1207344
anevilmeme

This is a contender for fundie post of the year.

9/14/2010 12:06:52 PM

#1207371
squeakerbot

That looks like sarcasm to me. It's exactly the sort of thing I would say if an argument was getting too serious for it's purpose.

9/14/2010 12:51:24 PM

#1207380
Zeus Almighty

Bizarro, I spit soda out of my nose. You owe me a keyboard.

9/14/2010 1:07:57 PM

#1207397
Anonymous A

This must be the best quote I've seen here in months. So much hilarious fail in just a single, short sentence.

9/14/2010 1:45:01 PM

#1207411
Evilution Teacher

Heaven-Sent doesn't know her biochemistry? I'm shocked.

Edit: Went back and read original thread. I think HeavenSent was being sarcastic; but still doesn't know much.

9/14/2010 2:36:37 PM
1 2 3